Peroxisome Proliferator-Activated Receptor -Independent Repression of Prostate-Specific Antigen Expression by Thiazolidinediones in Prostate Cancer Cells

In light of the potential use of the thiazolidinedione family of peroxisome proliferator-activated receptor(PPAR ) agonists in prostate cancer treatment, this study assessed the mechanism by which these agents suppress prostate-specific antigen (PSA) secretion in prostate cancer cells. Two lines of evidence indicate that the effect of thiazolidinediones on PSA downregulation is independent of PPAR activation. First, this thiazolidinedione-mediated PSA down-regulation is structure-specific irrespective of the relative PPAR agonist potency. Second, the PPAR -inactive analogs of troglitazone and ciglitazone [ 2TG (5-[4-(6-hydroxy-2,5,7,8-tetramethyl-chroman-2yl-methoxy)-benzylidene]-thiazolidine-2,4-dione) and 2CG (5[4-(1-methyl-cyclohexylmethoxy)-benzylidene]-thiazolidine2,4-dione), respectively] exhibit higher potency than the parent compound in inhibiting dihydrotestosterone (DHT)-stimulated PSA secretion. Although 10 M troglitazone and 2TG significantly inhibit PSA secretion, they do not alter the expression level of androgen receptor (AR) or interfere with DHT-activated nuclear translocation of AR. However, reporter gene and chromatin immunoprecipitation studies indicate that troglitazone and 2TG block AR recruitment to the androgen response elements within the PSA promoter. Thus, this study raises the question of whether the ability of oral troglitazone to reduce PSA levels in prostate cancer patients is therapeutically relevant. A major concern is that the concentration for troglitazone to mediate antitumor effects is severalfold higher than that of PSA down-regulation, which is difficult to attain at therapeutic doses. Nevertheless, it is noteworthy that troglitazone and 2TG at high doses were able to inhibit AR expression. From a translational perspective, separation of PPAR agonist activity from AR down-regulation provides a molecular basis to use troglitazone as a platform to design AR-ablative agents. Becauase prostate-specific antigen (PSA) is used as a surrogate marker for disease progression and response for prostate cancer treatments (for review, see Polascik et al., 1999), the effect of therapeutic agents on PSA expression warrants attention (for review, see Dixon et al., 2001). Because PSA expression and cell proliferation are independently regulated functions in prostate cancer cells (Cunha et al., 1987), a therapeutic agent may down-regulate PSA expression/secretion without inhibiting tumor cell growth. In such a case, a patient receiving this agent might be falsely considered to have a clinical response. Among a series of agents examined to date, the ability of thiazolidinediones (e.g., troglitazone) to down-regulate PSA is noteworthy (Hisatake et al., 2000; Mueller et al., 2000). This family of peroxisome proliferatoractivated receptor (PPAR ) agonists increases transcription of certain insulin-sensitive genes involved in the metabolism and transport of lipids through PPAR activation, thereby improving insulin sensitivity. Moreover, at high doses, these agents exhibit in vitro and in vivo antitumor effects against human prostate cancer (Kubota et al., 1998; Mueller et al., 2000; Kumagai et al., 2004), although the underlying mechanism remains elusive. In light of the role of PPAR in the regulation of prostatic epithelial proliferation This work was supported by National Institutes of Health grants CA94829 and CA112250. Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.105.018333. ABBREVIATIONS: PSA, prostate-specific antigen; PPAR , peroxisome proliferator-activated receptor ; DHT, dihydrotestosterone; AR, androgen receptor; FBS, fetal bovine serum; PPRE, peroxisome proliferator-activated receptor response element; TK, thymidine kinase; PBS, phosphatebuffered saline; TBST, Tris-buffered saline/Tween 20; ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction; ARE, androgen response element; 2TG, 5-[4-(6-hydroxy-2,5,7,8-tetramethyl-chroman-2-yl-methoxy)-benzylidene]-2,4-thiazolidinedione; 2RG, 5-{4-[2-(methylpyridin-2-yl-amino)-ethoxy]-benzylidene}-thiazolidine-2,4-dione; 2PG, 5-{4-[2-(5-ethyl-pyridin-2-yl)-ethoxy]-benzylidene}-thiazolidine-2,4-dione; 2CG, 5-[4-(1-methyl-cyclohexylmethoxy)-benzylidene]-thiazolidine-2,4-dione. 0026-895X/06/6905-1564–1570$20.00 MOLECULAR PHARMACOLOGY Vol. 69, No. 5 Copyright © 2006 The American Society for Pharmacology and Experimental Therapeutics 18333/3105867 Mol Pharmacol 69:1564–1570, 2006 Printed in U.S.A. 1564 at A PE T Jornals on Sptem er 8, 2017 m oharm .aspeurnals.org D ow nladed from and differentiation, thiazolidinediones have been suggested to be useful in the setting of adjuvant and chemopreventive treatments of prostate cancer (Lieberman, 2002; Koeffler, 2003; Jiang et al., 2004). More recently, accumulating evidence suggests that the effect of thiazolidinediones on cell cycle and apoptosis in cancer cells is dissociated from their PPAR agonist activity (Sugimura et al., 1999; Motomura et al., 2000; Okura et al., 2000; Gouni-Berthold et al., 2001; Palakurthi et al., 2001; Takeda et al., 2001; Bae and Song, 2003; Baek et al., 2003; Huang et al., 2005; Shiau et al., 2005). For example, there is discrepancy of 3 orders of magnitude between the concentration required to produce antitumor effects and that required to mediate PPAR activation. In addition, the antitumor effect seems to be structure-specific, irrespective of potency in PPAR activation (i.e., troglitazone and ciglitazone are active, whereas rosiglitazone and pioglitazone are not). More recently, we demonstrated that the effect of thiazolidinediones on apoptosis and cell cycle arrest in cancer cells was attributable, in part, to their ability to inhibit Bcl-xL/Bcl-2 functions and to ablate cyclin D1 expression (Huang et al., 2005; Shiau et al., 2005). Considering the potential use of these agents in inhibiting prostate carcinogenesis, the mechanism whereby these PPAR agonists repress PSA expression warrants investigation. By using PPAR -inactive thiazolidinedione derivatives, we obtained evidence that the effect of troglitazone and ciglitazone on PSA down-regulation was independent of PPAR activation. Moreover, the ability of low doses ( 10 M) of troglitazone and ciglitazone to suppress PSA expression was caused not by reduced AR expression but by a decrease in the AR response element (ARE) activity in the PSA promoter. Materials and Methods Reagents. Troglitazone and ciglitazone were purchased from Sigma (St. Louis, MO) and Cayman Chemical (Ann Arbor, MI), respectively. Rosiglitazone and pioglitazone were prepared from the respective commercial capsules by solvent extraction followed by recrystallization or chromatographic purification. 2TG (5-[4-(6-hydroxy-2,5,7,8-tetramethyl-chroman-2-yl-methoxy)-benzylidene]-thiazolidine-2,4-dione), 2CG (5-[4-(1-methyl-cyclohexylmethoxy)benzylidene]-thiazolidine-2,4-dione), 2RG (5-{4-[2-(methyl-pyridin2-yl-amino)-ethoxy]-benzylidene}-thiazolidine-2,4-dione), and 2PG (5-{4-[2-(5-ethyl-pyridin-2-yl)-ethoxy]-benzylidene}-thiazolidine-2,4dione) are thiazolidinedione derivatives with attenuated or unappreciable activity in PPAR activation (Huang et al., 2005; Shiau et al., 2005). These agents were dissolved at various concentrations in DMSO and were added to cells in medium with a final DMSO concentration of 0.1%. Dihydrotestosterone (DHT; Sigma, St. Louis, MO) was dissolved in 100% ethanol (8 mg/ml) as a stock solution for serial dilutions in water. Mouse antibodies against AR, PSA, and -tubulin were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Goat anti-rabbit and rabbit anti-mouse immunoglobulin G horseradish peroxidase conjugates were from Jackson ImmunoResearch Laboratories (West Grove, PA). Cell Culture. LNCaP and 22RV1 cells were purchased from the American Type Culture Collection (Manassas, VA). LNCaP cells were cultured in a T-75 flask with RPMI 1640 medium containing 10% heat-inactivated FBS at 37°C in a humidified incubator containing 5% CO2; 22RV1 cells were cultured in the same media supplemented with 4.5 mg/ml of glucose. For individual experiments, 10% FBS-supplemented RPMI 1640 medium was replaced by phenol redfree RPMI 1640 medium containing 10% charcoal/dextran-stripped FBS. The cells were cultured for 2 days before drug treatments. PSA Immunoassay. Quantitative determinations of PSA in culture medium were performed by using a human PSA enzyme-linked immunosorbent assay kit (Anogen, Mississauga, ON, Canada). In brief, LNCaP and 22RV1 cells were plated in 96-well plates (6000 cells/well) in phenol red-free RPMI 1640 medium with 10% charcoal/ dextran-stripped FBS without and with glucose, respectively, incubated for 48 h, and treated with the test agent at the indicated concentrations in the same medium in six replicates. Control cells received dimethyl sulfoxide vehicle at a concentration equal to that of drug-treated cells. At different time intervals, 20 l of the cultured medium was collected, diluted 10-fold with the sample diluent, and the amount of PSA was determined by following the manufacturer’s instructions. Absorbance at 450 nm was determined on a microtiter plate reader. Transfections and Luciferase Assay. The 6.0-kilobase PSApromoter-linked reporter plasmid PSA6.0-Luc and the human AR expression construct pCMVhAR were provided by Dr. Chawnshang Chang (University of Rochester Medical Center, Rochester, NY) and Dr. James Dalton (The Ohio State University, Columbus, OH), respectively. The PPRE-x3-TK-Luc reporter vector contains three copies of the PPAR-response element (PPRE) upstream of the thymidine kinase promoter-luciferase fusion gene and was kindly provided by Dr. Bruce Spiegelman (Harvard University, Cambridge, MA). LNCaP or DU145 cells were incubated in phenol red-free RPMI 1640 medium with 10% FBS until they reached 50 to 70% confluence on a 100-mm plate and were transfected with 6 g of each of the aforementioned plasmids using Fugene 6 (Roche, Indianapolis, IN) in RPMI 1640 medium. For each transfection, herpes simplex virus thymidine kinase (TK) promoter-driven Renilla reniformis luciferase was used as an internal control for normalization. After transfections, cells were incubated in 10% charcoal-stripped FBS and RPMI 1640 medium, subject to different treatments for the times indicated in Figs. 1 and 6 and collected with passive lysis buffer (Promega, Madison, WI). Luciferase activity in the cell lysates was determined by luminometry. All transfection experiments were carried out in triplicate wells and repeated separately at least three times. Immunoblotting. Cells in T-75 flasks were collected by scraping and suspended in 60 l of phosphate-buffered saline (PBS). Two microliters of the suspension was taken for protein analysis using the Bradford assay kit (Bio-Rad, Hercules, CA). To the remaining solution was added the same volume of 2 SDS-polyacrylamide gel electrophoresis sample loading buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 5% -mercaptoethanol, 20% glycerol, and 0.1% bromphenol blue). The mixture was sonicated briefly and then boiled for 5 min. Equal amounts of proteins were loaded onto 10% SDS-polyacrylamide gel electrophoresis gels. After electrophoresis, protein bands were transferred to nitrocellulose membranes in a semidry transfer cell. The transblotted membrane was washed twice with Tris-buffered saline containing 0.1% Tween 20 (TBST). After blocking with TBST containing 5% nonfat milk for 40 min, the membrane was incubated with the appropriate primary antibody in TBST-1% nonfat milk at 4°C overnight. All primary antibodies were diluted 1:1000 in 1% nonfat milk-containing TBST. After treatment with the primary antibody, the membrane was washed three times with TBST for a total of 15 min, followed by incubation with goat anti-rabbit or anti-mouse IgG-horseradish peroxidase conjugates (diluted 1:5000) for 1 h at room temperature and three washes with TBST for a total of 1 h. The immunoblots were visualized by enhanced chemiluminescence. Immunocytochemical Analysis of DHA-Stimulated AR Nuclear Localization. LNCaP cells were cultured on slides in six-well plates (200,000 cells/well) in 10% charcoal-stripped, FBS-supplemented phenol red-free RPMI 1640 and exposed to 10 nM DHT, 10 nM DHT plus 10 M troglitazone, or 2TG for 48 h, washed with Dulbecco’s PBS, fixed with 4% paraformaldehyde for 30 min at 37°C, and then washed with PBS twice. For staining of AR, the cells were permeabilized with 0.1% Triton X-100 in 1% FBS-containing PBS and treated with mouse monoclonal anti-AR (1:100 dilution) in PBS PPAR Agonist-Mediated PSA Down-Regulation 1565 at A PE T Jornals on Sptem er 8, 2017 m oharm .aspeurnals.org D ow nladed from containing 0.1% Triton X-100 and 0.2% bovine serum albumin at 4°C overnight and washed with PBS. For fluorescent microscopy, Alexa Fluor 488 goat anti-mouse IgG (1:200 dilution; Molecular Probes) was used for conjugating AR. The nuclear counterstaining was performed using a 4,6-diamidino-2-phenylindole–containing mounting medium (Vector Laboratories, Burlingame, CA) before examination. Images of immunocytochemically labeled samples were observed using a Nikon microscope (Eclipse E800) with an argon laser and a helium-neon, and appropriate filters (excitation wavelengths, 488 nm for AR and 543 nm for 4,6-diamidino-2-phenylindole). Chromatin Immunoprecipitation. ChIP was performed by using an EZ-Chip kit (Upstate Biotechnology, Inc., Lake Placid, NY) according to the manufacturer’s instructions. LNCaP cells were cultured in 10 ml of 10% charcoal/dextran stripped, FBS-supplemented phenol red-free RPMI 1640 medium for 48 h. After drug treatment for 12 h, cells were cross-linked with 10 ml of fresh medium containing 1% formaldehyde at room temperature for 10 min. Glycine solution (1 ml, 1.25 M) was added to stop the cross-linking reaction, and cells were washed twice with 5 ml of PBS. The cells were collected, suspended in 350 l of SDS lysis buffer, sonicated on wet ice by using a Virtis model Sonic 300 sonicator with five sets of 10-s pulses and 8% of max power, and centrifuged at 15,000g at 4°C for 10 min. Supernatants were collected, diluted with the dilution buffer, and treated with protein G agarose at 4°C for 1 h to preclean the chromatin. After a brief centrifugation at 4000g, the supernatant was collected into a fresh 1.5-ml microcentrifuge tube. Ten microliters of the supernatant was stored away at 4°C to be used as input, and the remaining supernatant was incubated with anti-AR (Upstate Biotechnology) at 4°C overnight. After immunoprecipitation, the solution was treated with 60 l of protein G agarose slurry at 4°C for 1 h, followed by a brief centrifuge at 4000g. The protein G beads were washed, 1 ml each in tandem, with ice-cold low-salt wash buffer, high-salt wash buffer, LiCl wash buffer, and Tris/EDTA buffer, followed by extraction with elution buffer twice. The eluted solution was added 8 l of 5 M NaCl and incubated at 65°C overnight. A spin column provided in the kit was used to purify DNA fragments. For PCR analysis, 1 l of input DNA extraction and 5 l of immunoprecipitated DNA extraction were used for 36 cycles of amplification. The primers for androgen response element (ARE)I (A/B), AREII (C/D), and the middle region (E/F) (Shang et al., 2002) were obtained from Integrated DNA Technologies (Coralville, IA). The sequences were as follows: A, TCTGCCTTTGTCCCCTAGAT; B, AACCTTCATTCCCCAGGACT; C, AGGGATCAGGGAGTCTCACA; D, GCTAGCACTTGCTGTTCTGC; E, CTGTGCTTGGAGTTTACCTGA; F, GCAGAGGTTGCAGTGAGCC.